Journal: Cell reports

Article Title: STK25 inhibits PKA signaling by phosphorylating PRKAR1A.

doi: 10.1016/j.celrep.2022.111203

Figure Lengend Snippet: Figure 1. STK25 inhibits PKA activity (A) Differential phosphoproteomic spectra of STK25+/+ and STK25/ cardiomyocytes. Members of the PKA signaling pathway are highlighted. (B) Ingenuity phosphoprotein pathway analysis. Orange indicates pathways upregulated in STK25/ cardiomyocytes, while blue indicates upregulation in STK25+/+. (C) PKA activity in response to 10 mM forskolin treatment for 30 min in STK25+/+ and STK25/ cardiomyocytes. n = 3 for each condition. (D) PKA activity in response to 10 mM forskolin treatment for 30 min in HEK293T cells overexpressing either empty vector, wild-type STK2,5 or kinase-dead K49R/ T174A. n = 3 for each. Bar graph data are represented as mean ± SD and analyzed in technical triplicates, *p < 0.05, **p < 0.01, ****p < 0.0001 using ANOVA and Tukey’s adjustment for multiple comparisons.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER SuperScriptTM III First-Strand Synthesis SuperMix Invitrogen Cat# 18080400 Real Time Glo cell viability assay Promega Cat# G9712 Deposited data Sequencing of WT versus STK25KO cardiomyocytes This paper NCBI GEO: GSE195514 Proteomic data This paper PRIDE ProteomeXchange: PXD031367 Experimental models: Cell lines HEK293T ATCC Cat# CRL-3216, RRID:CVCL_0063 HiPSC (WTC cell line) Material Transfer Agreements from Bruce Conklin, Gladstone Institute N/A Experimental models: Organisms/strains C57BL/6J mice (AABC1503) The Jackson Laboratory Strain #000664 Oligonucleotides On-TargetPlus siRNA targeting STK25 Horizon Discovery Cat# L-004873-00-0050 ON-TARGETplus nontargeting pool Horizon Discovery Cat# D-001810-10-50 MISSION esiRNA targeting PRKAR1A Sigma-Aldrich Cat# EHU071341 Fwd Primer for STK25: GCTCCTACCTAAAGAGCACCA IDT N/A Rev Primer for STK25: TGGCAATGTATGTCTCCTCCAG IDT N/A Fwd Primer for GAPDH: GGACTCATGACCACAGTCCATG IDT N/A Rev Primer for GAPDH: CAGGGATGATGTTCTGGAGAGC IDT N/A Recombinant DNA CRISPR-Cas9 gRNA for STK25 knockout in iPSC ORIGENE Cat# KN203215G CRISPR-Cas9 gRNA for STK25 knockout in mice Synthego Cat# sgRNA-stk25-7367, Cat# sgRNA-stk25-10150 Flag-Empty Vector control GeneCopoeia Cat# EX-NEG-M46 Flag-WT-STK25 vector GeneCopoeia Cat# EX-M0142-M46 Flag-K49R/T147A-STK25 vector Vector Builder N/A V5-PRKAR1A Vector Builder VB200124-1141aes V5-S77A/S83A-PRKAR1A Vector Builder VB200124-1126jtp V5-S77E/S83E-PRKAR1A Vector Builder VB200124-1127pst Software and algorithms Real-Time Analysis Illumina Illumina https://www.illumina.com/informatics/ sequencing-data-analysis.html Bcl2fastq 2.19 Illumina https://support.illumina.com/sequencing/ sequencing_software/bcl2fastq-conversionsoftware.html Kallisto 0.44.0 Bray et al. (2016) https://pachterlab.github.io/kallisto/ DESeq2 1.28.1 Love et al. (2014) https://bioconductor.org/packages/ release/bioc/html/DESeq2.html GSEA 4.10.0 Subramanian et al. (2005) https://www.gsea-msigdb.org/ gsea/index.jsp Cell Reports 40, 111203, August 16, 2022 e2

Techniques: Activity Assay, Plasmid Preparation

Journal: Cell reports

Article Title: STK25 inhibits PKA signaling by phosphorylating PRKAR1A.

doi: 10.1016/j.celrep.2022.111203

Figure Lengend Snippet: Figure 2. STK25 binds to and phosphorylates PRKAR1A (A) Immunoblot of PRKAR1A phospho-S77 and -S83 in STK25+/+ and STK25/ cardiomyocyte protein lysates. n = 3 for each condition. (B) Immunoblots of phosphor-S77 and -S83 of PRKAR1A in STK25/ cardiomyocytes transfected with empty vector (EV), wild-type STK25, and kinase dead K49R/T174A STK25. n = 2 for each condition. (C) Forskolin (10 mM, 30 min)-stimulated STK25+/+ and STK25/ cardiomyocytes immunoblotted for phosphorylation of PRKAR1A. n = 3 for each condition. (D) Immunoprecipitation of FLAG-STK25 expressed in HEK293T cells and immunoblotted for PRKAR1A, PRKA2A, and GM130 (positive control binding partner). n = 3 for each condition. (E) Co-immunoprecipitation of PRKAR1A-V5 with STK25 and PRKACA in HEK293T cells treated with forskolin (10 mM, 30 min). n = 3 for each condition. (F) In vitro kinase assay of purified STK25 and PRKAR1A, immunoblotted for phosphorylation of S77 and S83 of PRKAR1A. n = 3 for each condition. See also Figure S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER SuperScriptTM III First-Strand Synthesis SuperMix Invitrogen Cat# 18080400 Real Time Glo cell viability assay Promega Cat# G9712 Deposited data Sequencing of WT versus STK25KO cardiomyocytes This paper NCBI GEO: GSE195514 Proteomic data This paper PRIDE ProteomeXchange: PXD031367 Experimental models: Cell lines HEK293T ATCC Cat# CRL-3216, RRID:CVCL_0063 HiPSC (WTC cell line) Material Transfer Agreements from Bruce Conklin, Gladstone Institute N/A Experimental models: Organisms/strains C57BL/6J mice (AABC1503) The Jackson Laboratory Strain #000664 Oligonucleotides On-TargetPlus siRNA targeting STK25 Horizon Discovery Cat# L-004873-00-0050 ON-TARGETplus nontargeting pool Horizon Discovery Cat# D-001810-10-50 MISSION esiRNA targeting PRKAR1A Sigma-Aldrich Cat# EHU071341 Fwd Primer for STK25: GCTCCTACCTAAAGAGCACCA IDT N/A Rev Primer for STK25: TGGCAATGTATGTCTCCTCCAG IDT N/A Fwd Primer for GAPDH: GGACTCATGACCACAGTCCATG IDT N/A Rev Primer for GAPDH: CAGGGATGATGTTCTGGAGAGC IDT N/A Recombinant DNA CRISPR-Cas9 gRNA for STK25 knockout in iPSC ORIGENE Cat# KN203215G CRISPR-Cas9 gRNA for STK25 knockout in mice Synthego Cat# sgRNA-stk25-7367, Cat# sgRNA-stk25-10150 Flag-Empty Vector control GeneCopoeia Cat# EX-NEG-M46 Flag-WT-STK25 vector GeneCopoeia Cat# EX-M0142-M46 Flag-K49R/T147A-STK25 vector Vector Builder N/A V5-PRKAR1A Vector Builder VB200124-1141aes V5-S77A/S83A-PRKAR1A Vector Builder VB200124-1126jtp V5-S77E/S83E-PRKAR1A Vector Builder VB200124-1127pst Software and algorithms Real-Time Analysis Illumina Illumina https://www.illumina.com/informatics/ sequencing-data-analysis.html Bcl2fastq 2.19 Illumina https://support.illumina.com/sequencing/ sequencing_software/bcl2fastq-conversionsoftware.html Kallisto 0.44.0 Bray et al. (2016) https://pachterlab.github.io/kallisto/ DESeq2 1.28.1 Love et al. (2014) https://bioconductor.org/packages/ release/bioc/html/DESeq2.html GSEA 4.10.0 Subramanian et al. (2005) https://www.gsea-msigdb.org/ gsea/index.jsp Cell Reports 40, 111203, August 16, 2022 e2

Techniques: Western Blot, Transfection, Plasmid Preparation, Phospho-proteomics, Immunoprecipitation, Positive Control, Binding Assay, In Vitro, Kinase Assay

Journal: Cell reports

Article Title: STK25 inhibits PKA signaling by phosphorylating PRKAR1A.

doi: 10.1016/j.celrep.2022.111203

Figure Lengend Snippet: Figure 3. Phosphorylation of PRKAR1A inhibits PKA activity (A) Co-immunoprecipitations of V5-tagged PRKAR1A, S77A/S83A PRKAR1A, or S77E/S83 PRKAR1A and immunoblotting for PRKARCA in HEK293T cells stimulated with forskolin (10 mM, 30 min). n = 3 for each condition. (B) PKA activity in HEK293T cells stimulated with forskolin (10 mM, 30 min) and transfected with EV, wild-type PRKAR1A, S77A/S83A PRKAR1A mutant, or S77E/ S83E PRKAR1A mutant as indicated. (C) HEK293T cells transfected with the indicated vectors and assessed for growth by Real Time Glo for 5 h after stimulation with forskolin (10 mM). A repre- sentative Real Time Glo assay analyzed in sextuplicate ±SEM is shown. (D) PKA activity in HEK293T cells stimulated with forskolin (10 mM, 30 min) and either overexpressing STK25 and/or the siRNA of PRKAR1A. (E) Model of STK25 downregulation of the PKA pathway through phosphorylation of PRKAR1A. For all graphs in this figure, n = 3 for each condition, data are presented as mean ± SD and analyzed in technical triplicates, *p < 0.05, ***p < 0.001, and ****p < 0.0001 by ANOVA with Tukey’s adjustment for multiple comparisons. See also Figure S2.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER SuperScriptTM III First-Strand Synthesis SuperMix Invitrogen Cat# 18080400 Real Time Glo cell viability assay Promega Cat# G9712 Deposited data Sequencing of WT versus STK25KO cardiomyocytes This paper NCBI GEO: GSE195514 Proteomic data This paper PRIDE ProteomeXchange: PXD031367 Experimental models: Cell lines HEK293T ATCC Cat# CRL-3216, RRID:CVCL_0063 HiPSC (WTC cell line) Material Transfer Agreements from Bruce Conklin, Gladstone Institute N/A Experimental models: Organisms/strains C57BL/6J mice (AABC1503) The Jackson Laboratory Strain #000664 Oligonucleotides On-TargetPlus siRNA targeting STK25 Horizon Discovery Cat# L-004873-00-0050 ON-TARGETplus nontargeting pool Horizon Discovery Cat# D-001810-10-50 MISSION esiRNA targeting PRKAR1A Sigma-Aldrich Cat# EHU071341 Fwd Primer for STK25: GCTCCTACCTAAAGAGCACCA IDT N/A Rev Primer for STK25: TGGCAATGTATGTCTCCTCCAG IDT N/A Fwd Primer for GAPDH: GGACTCATGACCACAGTCCATG IDT N/A Rev Primer for GAPDH: CAGGGATGATGTTCTGGAGAGC IDT N/A Recombinant DNA CRISPR-Cas9 gRNA for STK25 knockout in iPSC ORIGENE Cat# KN203215G CRISPR-Cas9 gRNA for STK25 knockout in mice Synthego Cat# sgRNA-stk25-7367, Cat# sgRNA-stk25-10150 Flag-Empty Vector control GeneCopoeia Cat# EX-NEG-M46 Flag-WT-STK25 vector GeneCopoeia Cat# EX-M0142-M46 Flag-K49R/T147A-STK25 vector Vector Builder N/A V5-PRKAR1A Vector Builder VB200124-1141aes V5-S77A/S83A-PRKAR1A Vector Builder VB200124-1126jtp V5-S77E/S83E-PRKAR1A Vector Builder VB200124-1127pst Software and algorithms Real-Time Analysis Illumina Illumina https://www.illumina.com/informatics/ sequencing-data-analysis.html Bcl2fastq 2.19 Illumina https://support.illumina.com/sequencing/ sequencing_software/bcl2fastq-conversionsoftware.html Kallisto 0.44.0 Bray et al. (2016) https://pachterlab.github.io/kallisto/ DESeq2 1.28.1 Love et al. (2014) https://bioconductor.org/packages/ release/bioc/html/DESeq2.html GSEA 4.10.0 Subramanian et al. (2005) https://www.gsea-msigdb.org/ gsea/index.jsp Cell Reports 40, 111203, August 16, 2022 e2

Techniques: Phospho-proteomics, Activity Assay, Western Blot, Transfection, Mutagenesis, Glo Assay

Journal: Cell reports

Article Title: STK25 inhibits PKA signaling by phosphorylating PRKAR1A.

doi: 10.1016/j.celrep.2022.111203

Figure Lengend Snippet: Figure 4. Stk25 loss increases response to adrenergic stimulation in vivo (A) Immmunoblot of Stk25, Prkaca, Gapdh, phospho-S77, phospho-S83, and total Prkar1a in Stk25+/+ and Stk25/ whole-heart lysates. (B) Stk25+/+ and Stk25/ mouse heart lysates were assessed for PKA activity in vitro. (C) Representative m-mode images of Stk25+/+ and Stk25/ mouse hearts stimulated with either control or isoproterenol. (D) Echocardiographic measurements of ejection fraction (EF) and fractional shortening (FS) at unstimulated baseline and in response to isoproterenol, n = 5 for Stk25+/+ and n = 6 for Stk25/. (E) RT-PCR (left) from left ventricular myocardium of normal hearts (n = 6) or heart failure (n = 17) expressed as a ratio of the threshold cycle curve (Ct) of STK25 to GAPDH. Immunoblot (right) of STK25 and PRKAR1A expression and phosphorylation in protein lysates from left ventricular myocardium of normal hearts or failing hearts. Bar graphs presented as mean ± SD and analyzed in technical triplicates, *p < 0.05, **p < 0.01 by Student’s t test in (B), repeated measures two-way ANOVA with Sidak’s correction for multiple comparisons in (D), and Welch’s t test in (E). See also Figures S3 and S4 and Table S1.

Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER SuperScriptTM III First-Strand Synthesis SuperMix Invitrogen Cat# 18080400 Real Time Glo cell viability assay Promega Cat# G9712 Deposited data Sequencing of WT versus STK25KO cardiomyocytes This paper NCBI GEO: GSE195514 Proteomic data This paper PRIDE ProteomeXchange: PXD031367 Experimental models: Cell lines HEK293T ATCC Cat# CRL-3216, RRID:CVCL_0063 HiPSC (WTC cell line) Material Transfer Agreements from Bruce Conklin, Gladstone Institute N/A Experimental models: Organisms/strains C57BL/6J mice (AABC1503) The Jackson Laboratory Strain #000664 Oligonucleotides On-TargetPlus siRNA targeting STK25 Horizon Discovery Cat# L-004873-00-0050 ON-TARGETplus nontargeting pool Horizon Discovery Cat# D-001810-10-50 MISSION esiRNA targeting PRKAR1A Sigma-Aldrich Cat# EHU071341 Fwd Primer for STK25: GCTCCTACCTAAAGAGCACCA IDT N/A Rev Primer for STK25: TGGCAATGTATGTCTCCTCCAG IDT N/A Fwd Primer for GAPDH: GGACTCATGACCACAGTCCATG IDT N/A Rev Primer for GAPDH: CAGGGATGATGTTCTGGAGAGC IDT N/A Recombinant DNA CRISPR-Cas9 gRNA for STK25 knockout in iPSC ORIGENE Cat# KN203215G CRISPR-Cas9 gRNA for STK25 knockout in mice Synthego Cat# sgRNA-stk25-7367, Cat# sgRNA-stk25-10150 Flag-Empty Vector control GeneCopoeia Cat# EX-NEG-M46 Flag-WT-STK25 vector GeneCopoeia Cat# EX-M0142-M46 Flag-K49R/T147A-STK25 vector Vector Builder N/A V5-PRKAR1A Vector Builder VB200124-1141aes V5-S77A/S83A-PRKAR1A Vector Builder VB200124-1126jtp V5-S77E/S83E-PRKAR1A Vector Builder VB200124-1127pst Software and algorithms Real-Time Analysis Illumina Illumina https://www.illumina.com/informatics/ sequencing-data-analysis.html Bcl2fastq 2.19 Illumina https://support.illumina.com/sequencing/ sequencing_software/bcl2fastq-conversionsoftware.html Kallisto 0.44.0 Bray et al. (2016) https://pachterlab.github.io/kallisto/ DESeq2 1.28.1 Love et al. (2014) https://bioconductor.org/packages/ release/bioc/html/DESeq2.html GSEA 4.10.0 Subramanian et al. (2005) https://www.gsea-msigdb.org/ gsea/index.jsp Cell Reports 40, 111203, August 16, 2022 e2

Techniques: In Vivo, Activity Assay, In Vitro, Control, Reverse Transcription Polymerase Chain Reaction, Western Blot, Expressing, Phospho-proteomics

Journal: International journal of molecular sciences

Article Title: Knockout of the Cardiac Transcription Factor NKX2-5 Results in Stem Cell-Derived Cardiac Cells with Typical Purkinje Cell-like Signal Transduction and Extracellular Matrix Formation.

doi: 10.3390/ijms241713366

Figure Lengend Snippet: Figure 1. Schematic representation of the CrispR-Cas9 guided knockout of NKX2-5 in hiPSC using the pCAS-Guide vector as performed in this study. The pCAS-Guide vector and the donor DNA Luci- Puro were transfected via lipofection into SFS.1WT hiPSC. The pCAS-Guide controlled expression of Cas9 allows for the targeted knockout of the NKX2-5 gene and the integration of Luci-Puro into the accessible genome of the SFS.1WT cell.

Article Snippet: 2023, 24, 13366 10 of 17 Cas9 NKX2-5 Knockout Kit (Origene (Rockville, MD, USA) #KN511024) as described in the manufacturers’ instructions.

Techniques: CRISPR, Knock-Out, Plasmid Preparation, Transfection, Expressing

Journal: International journal of molecular sciences

Article Title: Knockout of the Cardiac Transcription Factor NKX2-5 Results in Stem Cell-Derived Cardiac Cells with Typical Purkinje Cell-like Signal Transduction and Extracellular Matrix Formation.

doi: 10.3390/ijms241713366

Figure Lengend Snippet: Figure 2. Generation of an NKX2-5KO hiPSC-line. (A) Exemplary hiPSC colony after 17 days of selection with Puromycin. (B) hiPSC culture of isolated, CrispR-Cas9-treated hiPSC colonies. The cells were differentiated towards hiPSC-derived cardiomyocytes. The pictures show the cells as hiPSC, as mesodermal/cardiac cells at day 4 of differentiation and as young cardiomyocytes at day 8 of differentiation. (C) Young cardiomyocytes derived from CrispR-Cas9-treated hiPSC were isolated at day 8 of differentiation and analysed for the expression of NKX2-5 via PCR. Clones 1, 3, 4, 5 show an amplified NKX2-5 fragment. Clone 2 lacks the NKX2-5 fragment at 146 bp (green square).

Article Snippet: 2023, 24, 13366 10 of 17 Cas9 NKX2-5 Knockout Kit (Origene (Rockville, MD, USA) #KN511024) as described in the manufacturers’ instructions.

Techniques: Selection, Isolation, CRISPR, Derivative Assay, Expressing, Clone Assay